Generate the custom efficient motif set

[hahahafeifeifei]

Hi,
I want to follow the pipeline in vamos paper to generate the efficient motif set using my assemblies. Is there any software or script that can be used?

Thank you,
Fei

[Zikun-Yang]

I have the same need to create the efficient motif. If you have solved the problem, please let me know.

Thanks.

[BidaGu]

Hi,

We have since enhenced the framework for TR boundary and motif generation. You can find all scripts and a snakemake pipeline under https://github.com/ChaissonLab/vamos/blob/master/buildTRs. Please feel free to adapt any of the scripts for your own use.

The pipeline is somewhat complex. But you can find a description of the idea in this manuscript: https://www.biorxiv.org/content/10.1101/2024.08.07.607105v1

[HLHsieh]

Hi,

I have some follow-up questions regarding the generation and use of custom efficient motif sets:

1. Could you please provide more details about the structure and content of this file (vamos.motif.hg38.v2.1.e0.1.tsv)? For example, the following line:

chr1	10617	10997	AGGCGCGCCGCGCCGGCGCAGGCGCAGAG,AGGCGCGCCGCGCCGGCGCAGGCGCAGAGACAC,ACACATGCTAGCGCGTCCAGGGGAGG,GGGAGGAGGCGTGGCGCAGGCGCAGAG,ACACATGCTAGCGCGCCCAGAGGCGTGGCACAGGCGCAGAG,ATGCTACCGCGTCCAGGGGTGGAGGCGTGGCGCAGGCGCAGAG,AGGCGCGCCGTGCTGCCGCAGGCGCAGAG,ATGCTAGCGCGTCCGGGGTGGAGGCGTGGCGCAGGCGCAGAG,AGGCGCGCCGCGCCGGCGCAGGCGCAGACAC,ACACATGCTAGCGCGTCCAGGGGGTGG,ACACGGGCGCGCCGCGCCGGCGCAGGCGCAGAG,AGGCGCGCCGTGCTGCCGCAGGCGCAGAGACAC,ACACATGCTAGGCGTGGCACAGGCGCAGAG,AGGCGTGGCACAGCGCGTCCAGGGGAGG,ACACATGCTAGCGCGCCCAGAGGCGCAGAG,ACACATGCTAGCGCGTCCAGG,AGCGCGTCGGGGTGGAGGCGTGGCGCAGGCGCAGAG,ATGCTAGCGCGTCCAGGGGAGGAGGCGTGGCACACAC,AGGCGCACAGACACATGCTAGCGCGCCCAG	v-2.0	VNTR	29	0	0

What does each column represent, particularly the last three numeric fields and the coordinate system?

2. Is it mandatory to run your provided script to generate an efficient motif set? For example, I’m interested in analyzing the GGCCC motif at C9orf72, with the coordinates: chr9 27573528 27573546 GGCCCC.

Can I manually convert this into the correct .tsv format for vamos input?

3. Is it possible to run vamos using just a single motif for detection? Additionally, if a sample contains a motif that is not included in the provided efficient motif set, how does vamos handle it? Will it be excluded or substituted?

4. I noticed that it works for STRs as well. Are there any limitations on the motif length (e.g., minimum or maximum number of bases)?

5. Does vamos support genotyping or annotation in polyploid organisms, or is it currently limited to haploid/diploid contexts?

Thank you for your time and assistance!

Best regards,
Hsin

[mchaisso]

Hi, I'll have to check with Bida for the meaning of all of the columns. For the other questions: It is not necessary to run efficient motif calculation - you can create custom motifs (we do so regularly for disease loci). You can use a single motif, and the repeat unit will be counted. I mean to add functionality to output differences from the motifs, but am waiting until there is a pressing case. There is no limitation for motif length, but larger motifs (> 1kb) will take more time and memory. Genotyping is limited to diploid right now - it uses a diploid phasing algorithm to partition reads before annotating tandem repeats. Best, -Mark

…

On Tue, Apr 8, 2025 at 10:53 PM HLHsieh ***@***.***> wrote: Hi, I have some follow-up questions regarding the generation and use of custom efficient motif sets: 1. Could you please provide more details about the structure and content of this file (vamos.motif.hg38.v2.1.e0.1.tsv)? For example, the following line: chr1 10617 10997 AGGCGCGCCGCGCCGGCGCAGGCGCAGAG,AGGCGCGCCGCGCCGGCGCAGGCGCAGAGACAC,ACACATGCTAGCGCGTCCAGGGGAGG,GGGAGGAGGCGTGGCGCAGGCGCAGAG,ACACATGCTAGCGCGCCCAGAGGCGTGGCACAGGCGCAGAG,ATGCTACCGCGTCCAGGGGTGGAGGCGTGGCGCAGGCGCAGAG,AGGCGCGCCGTGCTGCCGCAGGCGCAGAG,ATGCTAGCGCGTCCGGGGTGGAGGCGTGGCGCAGGCGCAGAG,AGGCGCGCCGCGCCGGCGCAGGCGCAGACAC,ACACATGCTAGCGCGTCCAGGGGGTGG,ACACGGGCGCGCCGCGCCGGCGCAGGCGCAGAG,AGGCGCGCCGTGCTGCCGCAGGCGCAGAGACAC,ACACATGCTAGGCGTGGCACAGGCGCAGAG,AGGCGTGGCACAGCGCGTCCAGGGGAGG,ACACATGCTAGCGCGCCCAGAGGCGCAGAG,ACACATGCTAGCGCGTCCAGG,AGCGCGTCGGGGTGGAGGCGTGGCGCAGGCGCAGAG,ATGCTAGCGCGTCCAGGGGAGGAGGCGTGGCACACAC,AGGCGCACAGACACATGCTAGCGCGCCCAG v-2.0 VNTR 29 0 0 What does each column represent, particularly the last three numeric fields and the coordinate system? 2. Is it mandatory to run your provided script to generate an efficient motif set? For example, I’m interested in analyzing the GGCCC motif at C9orf72, with the coordinates: chr9 27573528 27573546 GGCCCC. Can I manually convert this into the correct .tsv format for vamos input? 3. Is it possible to run vamos using just a single motif for detection? Additionally, if a sample contains a motif that is not included in the provided efficient motif set, how does vamos handle it? Will it be excluded or substituted? 4. I noticed that it works for STRs as well. Are there any limitations on the motif length (e.g., minimum or maximum number of bases)? 5. Does vamos support genotyping or annotation in polyploid organisms, or is it currently limited to haploid/diploid contexts? Thank you for your time and assistance! Best regards, Hsin — Reply to this email directly, view it on GitHub <#6 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AAKPGPR32WEPFUD7776LHHT2YSYXBAVCNFSM6AAAAAB2YATBT6VHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMZDOOBYGM2TGMRWGM> . You are receiving this because you are subscribed to this thread.Message ID: ***@***.***> *HLHsieh* left a comment (ChaissonLab/vamos#6) <#6 (comment)> Hi, I have some follow-up questions regarding the generation and use of custom efficient motif sets: 1. Could you please provide more details about the structure and content of this file (vamos.motif.hg38.v2.1.e0.1.tsv)? For example, the following line: chr1 10617 10997 AGGCGCGCCGCGCCGGCGCAGGCGCAGAG,AGGCGCGCCGCGCCGGCGCAGGCGCAGAGACAC,ACACATGCTAGCGCGTCCAGGGGAGG,GGGAGGAGGCGTGGCGCAGGCGCAGAG,ACACATGCTAGCGCGCCCAGAGGCGTGGCACAGGCGCAGAG,ATGCTACCGCGTCCAGGGGTGGAGGCGTGGCGCAGGCGCAGAG,AGGCGCGCCGTGCTGCCGCAGGCGCAGAG,ATGCTAGCGCGTCCGGGGTGGAGGCGTGGCGCAGGCGCAGAG,AGGCGCGCCGCGCCGGCGCAGGCGCAGACAC,ACACATGCTAGCGCGTCCAGGGGGTGG,ACACGGGCGCGCCGCGCCGGCGCAGGCGCAGAG,AGGCGCGCCGTGCTGCCGCAGGCGCAGAGACAC,ACACATGCTAGGCGTGGCACAGGCGCAGAG,AGGCGTGGCACAGCGCGTCCAGGGGAGG,ACACATGCTAGCGCGCCCAGAGGCGCAGAG,ACACATGCTAGCGCGTCCAGG,AGCGCGTCGGGGTGGAGGCGTGGCGCAGGCGCAGAG,ATGCTAGCGCGTCCAGGGGAGGAGGCGTGGCACACAC,AGGCGCACAGACACATGCTAGCGCGCCCAG v-2.0 VNTR 29 0 0 What does each column represent, particularly the last three numeric fields and the coordinate system? 2. Is it mandatory to run your provided script to generate an efficient motif set? For example, I’m interested in analyzing the GGCCC motif at C9orf72, with the coordinates: chr9 27573528 27573546 GGCCCC. Can I manually convert this into the correct .tsv format for vamos input? 3. Is it possible to run vamos using just a single motif for detection? Additionally, if a sample contains a motif that is not included in the provided efficient motif set, how does vamos handle it? Will it be excluded or substituted? 4. I noticed that it works for STRs as well. Are there any limitations on the motif length (e.g., minimum or maximum number of bases)? 5. Does vamos support genotyping or annotation in polyploid organisms, or is it currently limited to haploid/diploid contexts? Thank you for your time and assistance! Best regards, Hsin — Reply to this email directly, view it on GitHub <#6 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AAKPGPR32WEPFUD7776LHHT2YSYXBAVCNFSM6AAAAAB2YATBT6VHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMZDOOBYGM2TGMRWGM> . You are receiving this because you are subscribed to this thread.Message ID: ***@***.***>

[BidaGu]

Hi Hsin,

Thank you for using the tool! To supplement Mark's comments regarding your questions,

1. I have added a table on the github page to explain columns of the motif catalog. The coordinate system is either the GRCh38 or T2T-CHM13v2.0 reference. The name of the motif catalog file indicates which system it is. Please be noted that vamos only needs the first 4 columns (i.e., chrom,start,end,motifs) to run. All remaining columns are extra annotations of the locus to ease analysis for the users. We plan to add more annotations in our next release soon and will keep the github page updated.

2. It is not necessary to always generate motif catalog from our pipeline. We understand that TR is complex and customized configuration of TR loci and motifs are common. Therefore, vamos fully supports customized input motif catalogs and customization is easy. As I mentioned in (1), you only need the first 4 columns to make vamos work. So, you can fake the remaining columns and configure any customized locus.

3. To supplement Mark's comment, with a single motif input, all motifs in the TR string are substituted with this single motif by annotation. So, the annotation is essentially a count of the number of motif repeats. If you would like any different motif to be explicitly annotated, you need to manually add that extra motif to the input motif catalog. Please be noted that we also provided motif catalog before any efficient selection (i.e., the "oriMotifs" file). It contains motifs collected from the 94 HPRC genomes, which should represent good populaton diversity.

4. To supplement Mark's comment, we filtered loci that are > 10kb on the reference and excluded centromeric TRs.

Best,
Bida