diff --git a/config.json b/config.json
index a97f994..3725d5f 100644
--- a/config.json
+++ b/config.json
@@ -110,6 +110,14 @@
         "practices": [],
         "prerequisites": [],
         "difficulty": 2
+      },
+      {
+        "slug": "nucleotide-count",
+        "name": "Nucleotide Count",
+        "uuid": "9a2d0b74-0cba-464d-a960-8f7469be50a1",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2
       }
     ]
   },
diff --git a/exercises/practice/nucleotide-count/.busted b/exercises/practice/nucleotide-count/.busted
new file mode 100644
index 0000000..86b84e7
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.busted
@@ -0,0 +1,5 @@
+return {
+  default = {
+    ROOT = { '.' }
+  }
+}
diff --git a/exercises/practice/nucleotide-count/.docs/instructions.md b/exercises/practice/nucleotide-count/.docs/instructions.md
new file mode 100644
index 0000000..548d9ba
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.docs/instructions.md
@@ -0,0 +1,23 @@
+# Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```
diff --git a/exercises/practice/nucleotide-count/.meta/config.json b/exercises/practice/nucleotide-count/.meta/config.json
new file mode 100644
index 0000000..a89d28f
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "glennj"
+  ],
+  "files": {
+    "solution": [
+      "nucleotide_count.moon"
+    ],
+    "test": [
+      "nucleotide_count_spec.moon"
+    ],
+    "example": [
+      ".meta/example.moon"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}
diff --git a/exercises/practice/nucleotide-count/.meta/example.moon b/exercises/practice/nucleotide-count/.meta/example.moon
new file mode 100644
index 0000000..8122409
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/example.moon
@@ -0,0 +1,8 @@
+return (strand) ->
+  counts = A: 0, C: 0, G: 0, T: 0
+
+  for char in strand\gmatch(".")
+    error 'Invalid nucleotide in strand' unless counts[char]
+    counts[char] += 1
+
+  counts
diff --git a/exercises/practice/nucleotide-count/.meta/spec_generator.moon b/exercises/practice/nucleotide-count/.meta/spec_generator.moon
new file mode 100644
index 0000000..db3ecd1
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/spec_generator.moon
@@ -0,0 +1,20 @@
+{
+  module_name: 'nucleotide_count',
+
+  generate_test: (case, level) ->
+    local lines
+    if case.expected.error
+      lines = {
+        "f = -> nucleotide_count '#{case.input.strand}'",
+        "assert.has.errors f, '#{case.expected.error}'"
+      }
+    else
+      -- use "same", not "equal", to compare tables
+      lines = {
+        "expected = A: #{case.expected.A}, C: #{case.expected.C}, G: #{case.expected.G}, T: #{case.expected.T}"
+        "result = nucleotide_count '#{case.input.strand}'",
+        "assert.are.same expected, result"
+      }
+
+    table.concat [indent line, level for line in *lines], '\n'
+}
diff --git a/exercises/practice/nucleotide-count/.meta/tests.toml b/exercises/practice/nucleotide-count/.meta/tests.toml
new file mode 100644
index 0000000..7c55e53
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/tests.toml
@@ -0,0 +1,25 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[3e5c30a8-87e2-4845-a815-a49671ade970]
+description = "empty strand"
+
+[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
+description = "can count one nucleotide in single-character input"
+
+[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
+description = "strand with repeated nucleotide"
+
+[40a45eac-c83f-4740-901a-20b22d15a39f]
+description = "strand with multiple nucleotides"
+
+[b4c47851-ee9e-4b0a-be70-a86e343bd851]
+description = "strand with invalid nucleotides"
diff --git a/exercises/practice/nucleotide-count/nucleotide_count.moon b/exercises/practice/nucleotide-count/nucleotide_count.moon
new file mode 100644
index 0000000..911f666
--- /dev/null
+++ b/exercises/practice/nucleotide-count/nucleotide_count.moon
@@ -0,0 +1,4 @@
+counter = (strand) ->
+  error 'Implement me'
+
+return counter
diff --git a/exercises/practice/nucleotide-count/nucleotide_count_spec.moon b/exercises/practice/nucleotide-count/nucleotide_count_spec.moon
new file mode 100644
index 0000000..cc18d9c
--- /dev/null
+++ b/exercises/practice/nucleotide-count/nucleotide_count_spec.moon
@@ -0,0 +1,26 @@
+nucleotide_count = require 'nucleotide_count'
+
+describe 'nucleotide-count', ->
+  it 'empty strand', ->
+    expected = A: 0, C: 0, G: 0, T: 0
+    result = nucleotide_count ''
+    assert.are.same expected, result
+
+  pending 'can count one nucleotide in single-character input', ->
+    expected = A: 0, C: 0, G: 1, T: 0
+    result = nucleotide_count 'G'
+    assert.are.same expected, result
+
+  pending 'strand with repeated nucleotide', ->
+    expected = A: 0, C: 0, G: 7, T: 0
+    result = nucleotide_count 'GGGGGGG'
+    assert.are.same expected, result
+
+  pending 'strand with multiple nucleotides', ->
+    expected = A: 20, C: 12, G: 17, T: 21
+    result = nucleotide_count 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+    assert.are.same expected, result
+
+  pending 'strand with invalid nucleotides', ->
+    f = -> nucleotide_count 'AGXXACT'
+    assert.has.errors f, 'Invalid nucleotide in strand'